top of page

Bio lesson explaining some genetic research

Bio Lesson

Proteins make amino acids.There are about 20 Amino Acids, three base pairs code for an amino acid which can be represented with A-Z and 6 extra dummy acids. An extra base pair X has to be added to code for some letters as some codes are redundant and blanks are hard to find. Eg : the triplet ATA codes for I, there is ATCG base pairs and complementary in where A=T and C=G double strand. RNA has U instead of T.

There is 3D folding and active sites which is great

Protein COVID VACCINE length 13

DNA TGTAXTGTTATTGATXXXGTTGCTTGTTGTATTAATGAG length 39

RNA ACAUXACAAUAACUAXXXCAACGAACAACAUAAUUACUC length 39

Recent Posts

See All
Mutations in Covid

10^9 cases there are 10 muts, in 10^7 in Ind there is a mut. Both are within order or says that prob is 10^-7. Due to Vac it's complex....

 
 
 
Vaccine and corona dynamic

If net vac < 1-1/infecnfactor14days there can be a rise and fall will be after that day. We could have locked in first week. It's 2. So...

 
 
 

Comments


bottom of page